Кателицидины: Кателицидины (LL-37) – семейство антимикробных белков, главным

Электронный научный журнал Современные проблемы науки и образования ISSN 2070-7428

Кателицидины: Кателицидины (LL-37) - семейство антимикробных белков, главным
1 Тырнова Е.В. 1Алешина Г.М. 2Янов Ю.К. 1Кокряков В.Н.

2 1 ФГБУ «Санкт-Петербургский научно-исследовательский институт уха, горла, носа и речи» Минздрава России2 ФГБНУ «Институт экспериментальной медицины» Методом обратной транскрипции и полимеразной цепной реакции в режиме реального времени проведена оценка экспрессии генов антимикробных пептидов кателицидина LL-37 и бета-дефенсинов-1, -2, -3 человека (hBD-1, -2, -3) в эпителии слизистой оболочки среднего уха при хронических воспалительных заболеваниях (хронический средний отит, отосклероз) по уровню синтеза соответствующих матричных рибонуклеиновых кислот (мРНК). Исследовали 92 образца операционного материала: слизистая оболочка барабанной и мастоидальной полостей, суперструктур стремени, нижних и средних носовых раковин в качестве контроля. Частота детекции экспрессии мРНК hBD-2 в барабанной полости при отите с холестеатомой выше, чем в контроле и при отосклерозе: отношение шансов (ОШ) 8,80 (95 % доверительный интервал 1,35÷57,43), тимпаносклерозе ОШ=19,20 (1,88÷196,55), в мастоидальной полости ОШ=5,87 (1,08÷32,00); частота детекции экспрессии мРНК hBD-3 в барабанной полости при отите с холестеатомой выше, чем при отосклерозе ОШ=14,00 (1,39÷141,49). Экспрессия мРНК LL-37 детектирована в барабанной полости реже всего по сравнению с контролями при отосклерозе ОШ=31,15 (1,53÷633,17) и отите с холестеатомой ОШ=23,40 (1,15÷477,59). Уровни экспрессии гена LL-37 в эпителии среднего уха снижены по сравнению с полостью носа (p бета-дефенсин-1 человека (hbd-1)полимеразная цепная реакция (пцр) в режиме реального временислизистая оболочка среднего уха 1. Underwood M.A., Bevins C.L. Defensin-barbed innate immunity: clinical associations in the pediatric population // Pediatrics, 2010, vol. 125, no. 6, pp. 1237-1247.
2. Lee H.Y., Takeshita T., Shimada J., Akopyan A., Woo J.I., Pan H., Moon S.K., Andalibi A., Park R.K., Kang S.H., Kang S.S., Gellibolian R., Lim D.J. Induction of beta defensin 2 by NTHi requires TLR2 mediated MyD88 and IRAK-TRAF6-p38MAPK signaling pathway in human middle ear epithelial cells // BMC Infectious Diseases, 2008, vol. 8: 87. – URL: http://www.biomedcentral.com/1471-2334/8/87.
3. McGillivary G., Mason K.M., Jurcisek J.A., Peeples M.E., Bakaletz L.O. RSV-induced dysregulation of expression of a mucosal beta-defensin augments colonization of the upper airway by non-typeable Haemophilus influenza // Cellular microbiology, 2009, vol. 11, no. 9, pp. 1399–1408.
4. McGillivary G., Ray W.C., Bevins C.L., Munson R.S. Jr., Bakaletz L.O. A member of the cathelicidin family of antimicrobial peptides is produced in the upper airway of the chinchilla and its mRNA expression is altered by common viral and bacterial co-pathogens of otitis media // Molecular immunology, 2007, vol. 44, no. 9, pp. 2446-2458.
5. Lee H.Y., Andalibi A., Webster P., Moon S.K., Teufert K., Kang S.H., Li J.D., Nagura M., Ganz T., Lim D.J. Antimicrobial activity of innate immune molecules against Streptococcus pneumoniae, Moraxella catarrhalis and nontypeable Haemophilus influenza // BMC Infectious Diseases, 2004, vol. 4: 12. – URL: http://www.biomedcentral.com/1471-2334/4/12.
6. Li J.D., Hermansson A., Ryan A.F., Bakaletz L.O., Brown S.D., Cheeseman M.T., Juhn S.K., Jung T.T., Lim D.J., Lim J.H., Lin J., Moon S.K., Post J.C. Panel 4: Recent advances in otitis media in molecular biology, biochemistry, genetics, and animal models // Otolaryngology – head and neck surgery, 2013, vol. 148, suppl. 4, E52-63.
7. Medzhitov R., Schneider D.S., Soares M.P. Disease tolerance as a defense strategy // Science, 2012, vol. 335, no. 6071, pp. 936–941.
8. Оценка экспрессии генов бета-дефенсинов-1 и -2 человека и кателицидина LL-37 в слизистой оболочке верхних дыхательных путей / Е.В. Тырнова [и др.] // Цитокины и воспаление. – 2014. – Т. 13, № 2. – С. 89–95.
9. Изучение экспрессии гена бета-дефенсина-3 человека в слизистой оболочке верхних дыхательных путей / Е.В. Тырнова [и др.] // Рос. оторинолар. – 2015. – № 2(75). – С.77-84.
10. Jin Shin D., Gan-Undram S., Jin Kim S., Joon Jun Y., Jung Im G., Hyun Jung H. Expression of beta-defensins in the tubotympanum of experimental otitis media // Acta oto-laryngologica, 2006, vol. 126, no. 10, pp. 1040-1045.
11. Meyer J.E., Schwaab M., Beier U.H., Görögh T., Buchelt T., Frese K., Maune S. Association between human beta defensin expression and cholesteatoma formation // Auris, nasus, larynx, 2006, vol. 33, no. 2, pp. 159-165.
12. Woo J.I., Kil S.H., Brough D.E., Lee Y.J., Lim D.J., Moon S.K. Therapeutic potential of adenovirus-mediated delivery of β-defensin 2 for experimental otitis media // Innate immunity, 2015, vol. 21, no. 2, pp. 215-224.
13. Underwood M., Bakaletz L. Innate immunity and the role of defensins in otitis media // Current allergy and asthma reports, 2011, vol. 11, no. 6, pp. 499-507.
14. Wu M., McClellan S.A., Barrett R.P., Hazlett L.D. Beta-defensin-2 promotes resistance against infection with P. aeruginosa // Journal of immunology, 2009, vol. 182, no. 3, pp.1609-1616.
15. Jones E.A., McGillivary G., Bakaletz L.O. Extracellular DNA within a nontypeable Haemophilus influenzae-induced biofilm binds human beta defensin-3 and reduces its antimicrobial activity // Journal of innate immunity, 2013, vol. 5, no. 1, pp. 24-38.

Ключевым вопросом понимания патофизиологии среднего отита является то, каким образом полость среднего уха, непосредственно контактирующая с носоглоткой, заселенной микроорганизмами, включая этиологические агенты среднего отита, сохраняется стерильной у здоровых людей [1, 2]. Механизмы, лежащие в основе полимикробной природы среднего отита, не вполне ясны. Тем не менее имеются свидетельства, указывающие на то, что вирус-опосредованные повреждения эпителия, выстилающего слизистую оболочку верхних дыхательных путей, снижение мукоцилиарного клиренса и повышенная экспрессия клетками организма молекул, которые способствуют адгезии бактерий, вносят вклад в патогенез среднего отита [3].

Систему механизмов врожденного иммунитета считают неотъемлемой частью защиты среднего уха от инфекций. Респираторный эпителий слизистых оболочек, в том числе среднего уха и слуховой трубы, секретирует антимикробные молекулы (белки – лизоцим, лактоферрин и катионные пептиды – дефенсины и кателицидины).

Антимикробные пептиды (бета-дефенсины (hBD), кателицидин) играют основную роль в защите поверхности слизистых от широкого набора микроорганизмов (грамположительных и грамотрицательных бактерий, грибков, простейших и оболочечных вирусов), включая сочетанные вирусные и бактериальные патогены полимикробного заболевания – среднего отита, в том числе хронического среднего отита, рецидивирующего среднего отита и экссудативного среднего отита [4]. Пептиды обладают прямой и непрямой антимикробной активностью, могут выступать в качестве хемокинов, а также индуцировать продукцию хемокинов, приводящую к рекрутированию лейкоцитов в очаг инфекции, способствуют заживлению ран и способны модулировать адаптивный иммунный ответ.

Тестирование клинических изолятов респираторных патогенов среднего отита выявило бактерицидную активность hBD-2 в отношении грамотрицательных Moraxella catarrhalis, нетипируемого Haemophilus influenzae (NTHi) и грамположительного Streptococcus pneumoniae, а также бактерицидную активность hBD-1 в отношении M. catarrhalis и умеренный ингибирующий эффект на рост S. pneumoniae [5]. Кателицидин LL-37 и hBD-3 также действуют в туботимпануме и в микромолярных концентрациях убивают этиологические агенты среднего отита [4].

Многофакторная природа патогенеза хронического среднего отита включает в себя сложные взаимодействия микробных факторов, факторов риска окружающей среды и генетических факторов организма.

Реакции организма на вирусные и бактериальные патогены при среднем отите определяются, по большей части, экспрессией генов во время взаимодействия организм-патоген [6].

В отношении иммунитета в медико-биологических исследованиях упрочиваются позиции заимствованной из эволюционной биологии концепции, согласно которой существуют две альтернативные стратегии защиты от инфекции: стратегия резистентности, направленная на детекцию и элиминацию внедряющихся патогенов; и стратегия толерантности, как способность допускать (терпеть) присутствие патогена [7]. Изменения этих двух фундаментальных механизмов защиты часто участвуют в других формах хронических воспалительных заболеваний и могут быть связаны также со склонностью к среднему отиту.

Целью работы явилась оценка состояния молекулярно-генетических основ активации элиминационных механизмов врожденного иммунитета путем исследования экспрессии генов антибиотических пептидов кателицидина LL-37 и бета-дефенсинов-1, -2, -3 человека в эпителии слизистой оболочки среднего уха при хронических воспалительных заболеваниях на основе определения мРНК.

Материал и методы

Материалом для исследования служили 92 образца слизистой оболочки ЛОР-органов полученные во время планового хирургического вмешательства в условиях общей анестезии. Образцы тканей немедленно помещали в стабилизирующий раствор RNAlater.

Исследованы образцы слизистой оболочки барабанной и мастоидальной полости при разных формах хронического среднего отита и отосклерозе, в качестве контрольной ткани служили образцы слизистой нижних носовых раковин больных с искривлением перегородки носа, обычно используемые по данным литературы с этой целью. Вторым контролем служили образцы здоровой ткани слизистой оболочки среднего носового хода, полученные попутно в ходе операций. Образцы слизистой оболочки мастоидальной полости получены в случаях, когда объем операции требовал вскрытия клеток сосцевидного отростка.

Молекулярно-генетические исследования включали: выделение общей РНК из операционного материала, включающего поверхностный эпителий; синтез комплементарной к ДНК в реакции обратной транскрипции; амплификацию с использованием специфических праймеров и флюорофора SYBR Green (Bio-Rad) методом полимеразной цепной реакции (ПЦР) в режиме реального времени.

Уровень экспрессии мРНК стандартизировали относительно экспрессии гена бета-актина [8, 9].

Последовательности праймеров, использованных для ПЦР амплификации: LL-37: прямой 5' tcaccagaggattgtgacttcaa 3' и обратный 5' tgagggtcactgtccccatac 3'; hBD-1: прямой 5' tgctgtttactctctgcttacttttgt 3' и обратный 5' ccaaggcctgtgagaaagttacc 3'; hBD-2: прямой 5' tgatgcctcttccaggtgttt 3' и обратный 5' ggatgacatatggctccactctt 3'; hBD-3: прямой 5' tatcttctgtttgctttgctcttcc 3' и обратный 5' cctctgactctgcaataatatttctgtaat 3'; бета-актин человека: прямой 5' gggtcagaaggattcctatg 3' и обратный 5' ggtctcaaacatgatctggg 3'.

Статистическую обработку данных проводили с помощью программы GraphPad Prism 5 методами описательной статистики с использованием непараметрических критериев различия (тест Манна – Уитни). Значения p

Источник: https://science-education.ru/article/view?id=26906

Розацеа в фокусе большой науки. Косметологи на плечах дерматологов

Кателицидины: Кателицидины (LL-37) - семейство антимикробных белков, главным

Согласно клинико-статистическим данным, розацеа – весьма распространенное заболевание, как дерматологический диагноз ставится от 5 % до 20 % случаев. Причем за последние 10–15 лет этот показатель имеет стойкую тенденцию к повышению. Встречается розацеа у всех рас, но преимущественно у женщин I–II фототипов.

Следует подчеркнуть и социальное значение розацеа, поскольку впервые заболевание начинается на третьем десятилетии жизни и достигает расцвета к 40–50 годам на видимых участках кожи с запуском пролиферативных процессов и формированием фим. Представление о собственной непривлекательности пагубно влияет на психику пациентов, приводя к тревоге и депрессии.

Существует множество теорий возникновения розацеа.

Установлены следующие триггерные факторы розацеа:

  • ультрафиолетовое облучение (УФО)
  • длительное пребывание в условиях высокой или низкой температуры (суровые климатические условия)
  • острая и горячая пища
  • злоупотребление алкоголем
  • частые эмоциональные стрессы
  • физическое перенапряжение
  • нерациональный уход за кожей, в том числе использование средств ухода за кожей, содержащих циннамальдегид

Патофизиологические механизмы возникновения и развития розацеа до сих пор являются предметом научных споров.

Многочисленные исследования показывают участие большого количества иммунных клеток, клеток крови, протеаз, медиаторов воспаления, антимикробных пептидов, приводящих последовательно к гиперваскуляризации, воспалению и гиперплазии.

В последних исследованиях ключевая роль в развитии воспалительного процесса при розацеа отводится дисрегуляции иммунной детекции (иммунного ответа) в сочетании с нейрососудистыми изменениями. У больных розацеа отмечается гиперактивный иммунный ответ.

Воспаление при розацеа инициируется при участии TLR2 (Toll- receptor, Толл-подобные рецепторы) кератиноцитов. Эти трансмембранные структуры могут активироваться физическими факторами (УФО, высокими и низкими температурами), некоторыми антигенами (хитиновой оболочкой D. folliculorum, гликопротеидами B. oleronius), нейропептидами.

Дальнейшее развитие воспаления обусловлено секрецией кератиноцитами воспалительных протеаз (матричные металлопротеиназы, калликреинкиназы) и антимикробных пептидов (альфа-, бетадефензины и кателицидин LL-37). В настоящее время именно кателицидину LL-37 отводится значимая роль в развитии розацеа.

Этот антимикробный полипептид, состоящий из 37 аминокислот, относится к семейству калликреин-кинина. Его уровень в пораженной коже значительно повышен при всех субтипах розацеа. Продукция LL-37 усиливается под влиянием УФО (за счет синтеза витамина D), высоких и низких температур, инфекционных агентов.

Патофизиологические эффекты кателицидина LL-37 сводятся к повышению продукции хемокинов клетками дермы (лейкоцитами, гистиоцитами, тучными клетками), хемотаксису иммунных клеток в очаг воспаления, усилению пролиферации эндотелия сосудов и ангиогенеза (за счет увеличения секреции фактора роста эндотелия сосудов (VEGF – vascular endothelial growth factor)).

В результате нарушается архитектура межклеточного матрикса, неоангиогенез и регуляция нейрососудистых связей в коже. Формируется стойкая эритема и телеангиэктазии – основные признаки розацеа.

Клинические проявления при розацеа варьируют от незначительной эритемы, папулезных и пустулезных элементов до формирования фим.

В 1994 году дерматологи Г. Плевиг (G. Plewig) и А. М. Клигман (A. M. Kligman) предложили подразделять заболевание на классическое стадийное течение с учетом многообразных клинических вариантов.

Классические стадии розацеа:

  • Эпизодическая эритема (розацеа диатез)
  • Стадия 1 эритематозно-телеангиэктатическая: стойкая, умеренно выраженная эритема с рассеянными телеангиэктазиями
  • Стадия 2 папуло-пустулезная: стойкая, умеренно выраженная эритема, множественные телеангиэктазии, папулы, пустулы
  • Стадия 3 пустулезно-узловатая: стойкая, насыщенная эритема, густые скопления телеангиэктазий, образующие сосудистые пучки, особенно на носу, папулы, пустулы

Помимо классических вариантов розацеа авторы выделяют особые или атипичные варианты розацеа:

  • Персистирующий розацейный отек кожи
  • Офтальморозацеа: блефарит, конъюнктивит, ирит, иридоциклит, кератит
  • Люпоидная, или гранулематозная, розацеа
  • Стероидная розацеа
  • Грамнегативная розацеа
  • Молниеносная розацеа (rosacea fulminans)
  • Конглобатная розацеа
  • Фимы при розацеа: ринофима (нос), гнатофима (подбородок), метофима (лоб), отофима (ухо), блефарофима (веки)

В России общепринятой считается клинико-морфологическая классификация Е. И. Рыжковой (1976 год):

  1. Эритематозная стадия (rosacea erithematosa)
  2. Папулезная стадия (rosacea papulosa)
  3. Пустулезная стадия (rosacea pustulosa)
  4. Инфильтративно-продуктивная (rinophyma)
  5. Кистозная розацеа (гранулематозная)

Выделяют четыре основных типа розацеа (соответствующих эритематозной, папуло-пустулезной, гипертрофической стадиям и офтальморозацеа в прежних классификациях) и один вариант – гранулематозная розацеа.

Подтипы розацеа:

  • Подтип I – эритематозно-телеангиэктатический
  • Подтип II – папуло-пустулезный
  • Подтип III – фиматозный
  • Подтип IV – глазной

Для постановки диагноза используется следующая классификация клинических признаков, предложенная Дж. Вилкин (J. Wilkin) и соавт. в 2002 году.

Первичные признаки (наличие одного или более признаков) Вторичные признаки (наличие одного или более признаков)
  1. Переходящая эритема (транзиторная) центральной части лица, усиливающаяся в виде вспышек, телеангиэктазии
  2. Стойкая эритема
  3. Папулы и пустулы
  4. Телеангиэктазии
  1. Жжение или болезненность
  2. Бляшки (красные)
  3. Сухость кожи
  4. Отек
  5. Поражение глаз (глазные симптомы)
  6. Периферическое расположение высыпаний (экстрафациальная локализация)
  7. Фиматозные образования

Терапия розацеа

Многочисленные способы лечения розацеа определяются многообразием этиологических и патогенетических факторов дерматоза, его стадией и клинической формой.

Согласно научным данным, эффективность терапии розацеа зависит от давности заболевания, тяжести клинической формы и наличия сопутствующей патологии (инфекционной, соматической, эндокринной).

Наружное лечение является предпочтительным для всех типов розацеа, за исключением гипертрофического, при котором наиболее эффективными оказываются хирургическое лечение и системные синтетические ретиноиды.

Согласно современным клиническим рекомендациям, разрешенными препаратами для наружной терапии являются:

  • Метронидазол
  • Азелаиновая кислота
  • Антибактериальный препарат (клиндамицина фосфат, гель 1 % или клиндамицина гидрохлорид, раствор для наружного применения 1 %)
  • Топические ингибиторы кальциневрина
  • Бензоил пероксид
  • Топические ретиноиды

Препаратами для системного лечения являются:

  • Антибактериальные препараты «Доксициклин», «Эритромицин», «Кларитромицин»
  • Препараты группы 5-нитроимидазолов (альтернативные препараты при непереносимости или неэффективности антибактериальной терапии)
  • Системные ретиноиды (при тяжелой, резистентной к лечению розацеа)

При эритематозно-телеангиэктатическом подтипе применяется азелаиновая кислота, а также лазерные технологии. При папуло-пустулезном подтипе от легкой до умеренной степени тяжести рекомендуется азелаиновая кислота, метронидазол или короткий курс антибактериальных препаратов.

При тяжелом течении папуло-пустулезной розацеа рекомендуют четырехнедельный курс «Доксициклина» с последующим уменьшением дозы на 50 %. Показаны также низкие дозы изотретиноина.

При начальных проявлениях фиматозного подтипа розацеа наиболее эффективна монотерапия изотретиноином, в дальнейшем требуется хирургическое иссечение пораженных тканей.

Профилактика рецидивов розацеа должна включать назначение фотопротекторных средств с UVA/UVB-защитой SPF (Sun Protection Factor, солнцезащитный фактор)>30 (диоксид титана, оксид цинка, защитные силиконы: диметикон, циклометикон). Использование фотопротекторов снижает синтез витамина D, секрецию антимикробных пептидов, в первую очередь кателицидина LL-37, и предотвращает развитие воспаления в коже.

В современной дерматологии и косметологии широкое применение при терапии розацеа получили физиотерапевтические методы воздействия, а также лазеротерапия.

В терапии розацеа используются источники некогерентного интенсивного светового излучения (IPL) и диодные, КТР, александритовые, длинноимпульсные неодимовые лазеры на аллюмо-итриевом гранате, Сandela V-Beam. В лечении гипертрофического типа розацеа лазерная дермабразия занимает одну из ведущих позиций в силу своей безопасности.

Воздействие лазера осуществляется посредством селективного поглощения излучения хромофорами (меланин, гемоглобин, оксигемоглобин) сосочкового слоя дермы.

Принцип работы заключается в абсорбции фотонов хромофором-мишенью (при розацеа это оксигемоглобин), располагающимся в различных слоях кожи, и переносе энергии на данный хромофор, что приводит к локальному повышению температуры внутри сосуда и термолизу эндотелия.

Кровоток в поврежденном сосуде прекращается, и в течение 2–3 недель он облитерируется. Фототип кожи пациента, а также разновидность розацеа, являются определяющими факторами при выборе спектра света, который регулируется специальными оптическими фильтрами.

Современные лазеры позволяют обрабатывать пораженную область на всех этапах лечения розацеа, а также совмещать наружную медикаментозную терапию с лазерным воздействием.

Выделенный спектр волн при работе с лазером воздействует только на целевые объекты: сосуды и пигмент. При этом в процесс не вовлекаются другие кожные структуры, что минимизирует риск ожогов и позволяет использовать самую высокую допустимую энергию. Больным с розацеа показан также курс микротоковой терапии, как в острый период, так и в во время реабилитации.

Эффект заключается в воздействии слабых импульсных токов на нервно-мышечную передачу, на сосуды микроциркуляторного русла, на тонус гладкомышечных элементов структур кожи.

Благодаря такому комплексному воздействию нормализуется микроциркуляция в кровеносных и лимфатических сосудах кожи, осуществляется дренажное и противовоспалительное действие в пределах пораженных тканей.

Источник: https://www.1nep.ru/articles/210999/

Памятка по аттестации

Кателицидины: Кателицидины (LL-37) - семейство антимикробных белков, главным
sh: 1: –format=html: not found

Памятка по аттестации

    Согласно приказу Министерства здравоохранения и социального развития Российской Федерации от 25 июля 20011 года № 808н «О прядке получения квалификационных категорий медицинскими и фармацевтическими работниками» утверждено Положение о порядке получения квалификационных категорий медицинскими и фармацевтическими работниками, определяющее порядок получения квалификационных категорий специалистами.

     Обращаем внимание  на некоторые пункты данного Положения:

– квалификационная категория действительна в течении пяти лет, со дня издания приказа о ее присвоении.

– квалификационные категории присваиваются специалистам, имеющим уровень теоретических и практических навыков, соответствующих квалификационным характеристикам специалистов, и стаж работы по специальности:

 вторая – не менее 3 лет для специалистов с высшим и средним профессиональным образованием;

 первая – не менее 7 лет для специалистов в высшим и не менее 5 лет для специалистов со средним профессиональным образованием;

высшая – не менее 10 лет для специалистов в высшим и не менее 7 лет для специалистов со средним профессиональным образованием.

 В случае утери квалификационной категории (истек срок) присвоение начинается со второй квалификационной категории.

Порядок получения квалификационных категорий для женщин, вышедших из отпуска по беременности и родам, и лицами, находящимися в отпуске по уходу за ребенком в возрасте до трех лет следующий: документация направляется в аттестационную комиссию также не позднее четырех месяцев до окончания срока действия квалификационной категории, с предоставлением отчета о профессиональной деятельности за фактически отработанные – три года – для специалистов с высшим профессиональным образованием, и за последний год работы для работников со средним профессиональным образованием.

 Кроме того, в настоящее время данная процедура проводится только с  участием специалиста (не предусмотрено проведение заочной формы аттестации).

Специалисты, изъявившие желание получить (подтвердить) квалификационную категорию, представляют в аттестационную комиссию квалификационную документацию за 4 месяца до окончания срока категории.

Перечень документов,

необходимых для предоставления государственной услуги

Для присвоения (подтверждения) квалификационной категории в аттестационную комиссию министерства предоставляются следующие документы:

а) заявление специалиста на имя председателя аттестационной комиссии министерства, в котором указывается квалификационная категория, на которую он претендует, наличие или отсутствие ранее присвоенной квалификационной категории, дату ее присвоения, личная подпись специалиста и дата по форме (см. приложение);

б) заполненный в печатном виде квалификационный лист, заверяемый отделом кадров медицинской организации, в которой работает специалист, по форме (см. приложение);

в) отчет о профессиональной деятельности специалиста, согласованный с руководителем организации и заверенный ее печатью, и включающий анализ профессиональной деятельности за последние три года работы – для специалистов с высшим профессиональным образованием и за последний год работы – для работников со средним профессиональным образованием с их личной подписью (отчет должен содержать выводы специалиста о своей работе, предложения по улучшению организации оказания и качества медицинской помощи населению; отчет должен содержать достоверные данные в описании работ, выполненных специалистом, рационализаторских предложений, патентов). В случае отказа руководителя медицинской организации в согласовании отчета о профессиональной деятельности специалиста руководитель выдает письменное разъяснение о причинах отказа, которое прилагается к аттестационной документации;

г) копии документов об образовании (диплом, удостоверение об интернатуре (ординатуре), свидетельство о повышении квалификации, диплом о профессиональной переподготовке, сертификат специалиста по заявленной специальности), трудовой книжки, заверенные в установленном порядке;

д) в случае смены фамилии, имени, отчества – копия документа, подтверждающего факт смены фамилии, имени, отчества;

е) копию удостоверения о присвоении квалификационной категории (при наличии) или копию правового акта о присвоении квалификационной категории.

Образцы квалификационных документов прилагаются (образец заявления, квалификационный лист, титульный лист отчета).

 Все документы подшиваются в порядке указанном в перечне документов.

Обращаем Ваше внимание на правильность заполнения следующих пунктов:

 – наименование учреждения не сокращается;

 – в строке «специальность» указывается специальность, а не занимаемая должность;

– заполняются все виды профессионального образования (специализации, тематические усовершенствования, профессиональная переподготовка);

 – обратите внимание, на отсутствие расхождений мест работы и учебы с записями в трудовой книжке;

– в стаж работы по специальности не включается стаж работы по другим специальностям;

– в строке служебный и домашний адрес указывается индекс, наименование города, поселка, улицы, номера дома и телефон;

– квалификационный лист заполняется в печатном виде.

Характеристика на специалиста должна быть полной, раскрывающая профессиональные качества специалиста, отражающая навыки и умения, профессиональный рост.

Общий объем отчета составляет не более 10-15 страниц. Отчет должен быть напечатан на принтере через 1,5 интервал, иметь поля. Таблицы, рисунки и графики выполняются на стандартных листах. Страницы отчета, включая иллюстрации и приложения, нумеруются по порядку.

График приема квалификационных документов в ОГБУЗ «МИАЦИО»:

Источник: http://asld.baikal.ru/index.php?id=52&Itemid=53&option=com_content&task=view

Антимикробные пептиды в патогенезе воспалительных процессов кожи

Кателицидины: Кателицидины (LL-37) - семейство антимикробных белков, главным

Кожа человека является органом, выполняющим множество функций, одной из которых является защита организма от микроорганизмов, вирусов и бактерий. Защитная функция кожи человека реализуется с помощью нескольких механизмов, важнейшим из которых является иммунная система.

Иммунная система кожи состоит из двух систем: врожденной (естественной) и адаптивной (приобретенной). Врожденная система иммунитета характеризуется отсутствием иммунологической памяти. В результате действия компонентов этой системы происходит повреждение тканей вследствие воспалительной реакции.

Механизмы этой системы более просты, чем приобретенной, однако их нарушения могут привести к серьезным последствиям. Адаптивный иммунитет основан на способности Т- и В-лимфоцитов избирательно адаптироваться для каждого конкретного антигена с образованием клеток памяти.

Обе системы иммунитета находятся в тесной взаимосвязи, и нарушения одной из систем вызывают изменения в другой.

К врожденной системе иммунитета кожи относят комплемент, нейтрофилы, эозинофилы, натуральные киллеры (NK), тучные клетки, цитокины и открытые сравнительно недавно антимикробные пептиды (АМП).

Комплемент состоит из 20 гликопротеинов плазмы, которые активируются с помощью классического и альтернативного путей. Недавно открыт новый путь активации — посредством связывания карбогидратов микробной стенки с маннозосвязывающими белками. Все три пути приводят к активации С3-компонента и выработке иммуноактивных веществ.

Функции макрофагов, нейтрофилов, эозинофилов, натуральных киллеров, тучных клеток изучены более детально. Основной их задачей является нейтрализация различных антигенов, микроорганизмов и паразитов.

Цитокины — группа низкомолекулярных веществ, которые вырабатываются практически всеми клетками и обеспечивают межклеточное взаимодействие.

В механизмах врожденного иммунитета в основном играют роль цитокины воспаления: интерлейкины (IL) — 1, 6, фактор некроза опухоли альфа (ФНО-α), воспалительные хемокины, а также противовирусные интерфероны α и β (IFN-α, -β).

В реакциях адаптационного приобретенного иммунитета участвуют цитокины с иммуномодулирующими свойствами — IL-2, IL-4, IL-10, IL-12, IL-13, IL-18, IL-23, IFN-γ.

Врожденная иммунная система обладает механизмом распознавания молекулярных частиц микроорганизмов. Распознавание антигенов в организме происходит с помощью различных рецепторов. Молекулярные механизмы иммунного распознавания микробной клетки в организме человека изучены не полностью.

Рецепторы клеток иммунной системы, связывающиеся с микробным агентом, называют Toll-рецепторами (ТР). Их в настоящее время открыто десять. Каждый из Toll-рецепторов ответственен за распознавание различных компонентов клеточной стенки бактерий.

Так, например, ТР-2 связывается с липопротеинами и пептидогликанами грамположительных бактерий, ТР-4 распознают липополисахариды грамотрицательных бактерий, ТР-5 — с флагеллином — компонентом жгутиков бактерий, ТР-9 — распознает последовательности ДНК бактерий. Вероятно, Toll-рецепторы способны связываться и с вирусными частицами.

Связывание с ТР приводит к активации фактора транскрипции (NFkB) и выработке интерферонов. Дендритные клетки также имеют Toll-рецепторы, после активации которых антигены представляются интактным Т-лимфоцитам, обеспечивая таким образом связь между врожденной и приобретенной системой иммунитета.

В настоящее время известно сравнительно немного о роли антимикробных пептидов в защите кожи, однако дальнейшее их изучение может привести к синтезу новых противомикробных препаратов, устойчивость к которым будет развиваться медленнее, чем к синтезированным антибиотикам. Первый антимикробный пептид — β-дефензин-2 — был выделен из чешуек кожи больных псориазом.

Антимикробные пептиды — факторы врожденной системы иммунитета, защищающие кожу от микробов, грибов и, возможно, вирусов.

Выработка этих веществ в организме индуцируется микробными частицами путем связывания с Toll-рецепторами, однако, по всей видимости, это не единственный механизм. Их действие можно сравнить с природными антибиотиками, которые способны убивать бактерии.

Исследования на моделях животных показали, что при подавлении генов, ответственных за синтез антимикробных пептидов, у животных значительно возрастает чувствительность к стрептококковым инфекциям.

Известны два семейства антимикробных пептидов — кателицидины и дефензины.

Кателицидины — группа антимикробных белков, обладающих N-терминальным сигнальным белком, неизменной кателиновой частью и структурно изменяющимся С-участком.

Кателицидины обладают широким спектром антимикробной и иммуномодуляторной активности. У человека и мышей существует только один ген, ответственный за выработку кателицидинов, в то время как у других млекопитающих их несколько.

Антимикробные пептиды, синтезируемые в разных клетках, могут иметь различные функции.

Кателицидин LL-37, который синтезируется в клетках эккриновых желез и выделяется с потом, обеспечивает его противомикробные свойства, а молекулы LL-37, вырабатываемые в тучных клетках, способствуют их активации и вовлекают их в иммунный процесс.

Наряду с прямой антимикробной способностью этот белок взаимодействует с другими белками, вызывает миграцию нейтрофилов, моноцитов и Т-клеток, стимулирует пролиферацию эндотелия. У новорожденных содержание LL-37 повышено, что компенсирует недостаточность адаптационного иммунитета.

Дефензины характеризуются наличием шести цистеиновых частиц с тремя дисульфидными мостиками. На сегодняшний день открыты 6 α- и 4 β-дефензина. α-дефензины вырабатываются нейтрофилами и клетками желудочно-кишечного тракта. β-дефензины встречаются в коже и дыхательном тракте.

Как и каталицидины, дефензины обладают широким спектром противомикробной активности и вместе с тем стимулируют выработку ФНО-α и IL-1 моноцитами.

β-дефензин-2 отсутствует в здоровой коже, однако появляется при воспалительных процессах, при которых способствует выбросу гистамина и простагландина из тучных клеток.

Кроме этих двух наиболее изученных групп антимикробных пептидов, показано, что некоторые другие протеины — ингибиторы протеиназы, хемокины и нейропептиды — обладают противомикробными свойствами. Механизмы их противомикробного действия различны и зависят от строения их молекул.

Антимикробные пептиды, играющие роль в обеспечении противомикробной защиты кожи у человека, представлены в табл. 1.

Концентрация антимикробных пептидов в коже различна. У здоровых лиц содержание антимикробных пептидов повышено в тех участках кожи, где более вероятно проникновение инфекции — в частности, в коже подмышечных областей и потовых железах.

Повышенные концентрации этих пептидов препятствуют вторичному инфицированию кожных высыпаний при хронических кожных заболеваниях. Так, например, содержание LL-37 повышено при псориазе, красной волчанке и контактном дерматите.

У больных псориазом также повышено содержание β-дефензинов-2 и -3, что препятствует вторичному инфицированию бляшек.

При атопическом дерматите происходит обратное: содержание антимикробных пептидов снижено, что приводит к повышенной восприимчивости к различным инфекциям.

Антимикробные пептиды проливают свет на патогенез розацеа, при котором отмечается значительно большее содержание кателицидинов в коже.

У больных розацеа молекулы антимикробных пептидов отличаются от таковых у здоровых лиц, что связано также с повышенным содержанием трипсинового фермента рогового слоя кожи (SCTE). Введение LL-37 совместно с SCTE приводит к развитию розацеаподобного дерматита у мышей.

Этот механизм частично объясняет эффективность применения тетрациклинов у больных розацеа, действие которых направлено не на микробный агент, а является иммодуляторным (рис. 1).

Этот механизм позволяет обосновать применение противовоспалительных дозировок тетрациклинов, которые значительно ниже применяемых обычно доз и обладают меньшими побочными эффектами.

LL-37 обнаруживают в эпидермисе больных бородавками и остроконечными кондиломами, что подтверждает их роль в защите от папилломавирусных инфекций. β-дефензинов-1 и -2 значительно выше у больных с акне и распространенным фолликулитом, чем у здоровых лиц.

При язвенных поражениях кожи факторы роста, участвующие в заживлении раны, стимулируют синтез кателицидинов. Концентрация LL-37 зависит от длительности существования язвы, при острых язвах уровень LL-37 повышен, а при хронических язвах — низкий. Показано, что кателицидины могут стимулировать и ангиогенез, способствуя таким образом реваскуляризации поврежденной ткани.

При острых поражениях тканей кожи, например, при ожогах, антимикробные пептиды не успевают синтезироваться и содержание β-дефензинов не повышено, что объясняет частое инфицирование ожоговых поражений и развитие септических осложнений.

Таким образом, антимикробные пептиды являются звеном иммунитета, которое играет роль в патогенезе воспалительных заболеваний и обеспечивает защиту кожи. Дальнейшее изучение антимикробных пептидов может пролить свет на патогенез многих воспалительных заболеваний кожи и позволит разработать новые подходы терапии, основанные на молекулярных механизмах.

Козловская В. В. Гомельский государственный медицинский университет.
Журнал «Медицинская панорама» № 1, январь 2009.

Источник: https://www.plaintest.com/dermatology/antimicrobial

Как лечить розацеа?

Кателицидины: Кателицидины (LL-37) - семейство антимикробных белков, главным

Современный взгляд на проблему этиопатогенеза и терапии розацеа.

А. В. Карпова, Э. А. Баткаев

Кафедра клинической микологии и дерматовенерологии ФПК МР РУДН

Резюме: В настоящей статье рассматривается современный взгляд на проблему этиопатогенеза розацеа: отражена роль антимикробных пептидов, фактора роста эндотелия сосудов, антигена D. Folliculorum. Актуальность исследования обусловлена ростом заболеваемости, частыми рецидивами течение заболевания, недостаточной эффективностью существующих методов лечения.

Цель исследования: Оценить воздействие комплексной терапии, включающей применение ретинола пальмитата в качестве себорегулирующего препарата.

Дизайн исследования включал микроскопическое исследование соскоба с себорейных зон кожи лица, биохимическое исследование крови, оценку клинических симптомов до и после проводимой терапии.

Материалы и методы: Под нашим наблюдением находилось 19 пациентов, имеющих папуло —  пустулёзный подтип розацеа, осложнённый D. Folliculorum (подтверждённый лабораторно).

Все пациенты получали комплексную терапию, включающую антибактериальные средства  (антибиотики, метронидазол), препараты ангиопротекторного действия, себорегулирующего действия – ретинола пальмитат, который  применяли в дозе 200 — 300 тыс. МЕ.

Результаты: Оценка комплексной терапии розацеа, включающей применение ретинола пальмитата, показала положительную динамику клинических симптомов заболевания у 16 пациентов (80%) через 3 месяца от начала лечения.

Заключение: Изучение и анализ взаимодействия факторов, участвующих в патогенезе розацеа, позволит усовершенствовать методы лечения и прогнозирование течения заболевания.

Ключевые слова: розацеа, антиген D. Folliculorum, антимикробные пептиды, вазоактивные пептиды, ретинола пальмитат, криотерапия.

Summary: This article considers the modern view on the pathogenesis problem of acne rosacea: the role of antimicrobial peptides, vascular endothelial growth factor, antigen D.Folliculorum. Relevance of the study due to the increasing incidence, frequent relapses of the disease, and the low efficiency of treatment regimens.

The purpose of the study is the complex regimen, which includs the use of retinol palmitate as Sebo-regulating drug.

Design studies includes microscopic examination of a scraping from the seborrheic areas of the skin, biochemical blood tests, evaluation of clinical symptoms before and after the therapy.

Materials and methods: Under our observation there were 19 patients with papulo — pustular acne rosacea subtype complicated D. Folliculorum (laboratory confirmed). All patients received combined therapy including antibacterial agents (antibiotics, metronidazole), angioprotective drugs, and retinol palmitate, which was used in a dose of 200 — 300 thousand IU.

Results: the evaluation of acne rosacea complex therapy with application of the retinol palmitate showed positive dynamics of clinical symptoms of the disease in 16 patients (80%) after 3 months of starting treatment.

Conclusion: the study and analysis interaction factors involved in the pathogenesis of acne rosacea will improve treatment methods and prognosis of the disease.

Key words: acne rosacea, antigen D. Folliculorum, antimicrobial peptides, vasoactive peptides, retinol palmitate,cryoterapy.

Розацеа – хронический полиэтиологический дерматоз, реализующийся патологической реакцией сосудов под влиянием вазоактивных пептидов, антител, циркулирующих иммунных комплексов и характеризующийся рецидивирующим течением, стадийностью и проявляющийся гиперэмией лица, папулами, пустулами, телеангиоэктазией, гиперплазией сальных желёз и соединительной ткани[3].

Проблема розацеа приобретает все большее значение в современной дерматологии. Актуальность исследования обусловлена ростом заболеваемости, частыми рецидивами течение заболевания, недостаточой эффективностью существующих методов лечения. Широкое разнообразие клинических форм розацеа вызывает споры в установлении причин патогенеза данного заболевания.

Предрасполагающими факторами (триггерами), вызывающими развитие или обострение розацеа, являются солнечное излучение, стресс, изменение гормонального баланса, некоторые лекарственные препараты, в частности кортикостероидные гормоны, алкоголь, определенные пищевые продукты, инфицирование микроорганизмами (Demodex folliculorum и Helicobacter pylori) [8].

Частота обсемененности кожи здоровых людей Demodex folliculorum колеблется от 19,3 до 61,2 %. Наиболее часто клещей обнаруживают у пожилых людей и у пациентов с розацеа; в последнем случае обсемененность паразитами достигает до 96%[2].

Ключевую роль в патогенезе розацеа играет кожный воспалительный процесс. Воспаление инициируется при участии TLR2 (Toll- receptor, Толл-подобные рецепторы) кератиноцитов. Эти трансмембранные структуры могут активироваться физическими факторами (УФО, высокими и низкими температурами), рядом антигенов (хитиновой оболочкой D.

folliculorum, гликопротеидами B. Oleronius.  В дермальных инфильтратах в области поражений обнаруживаются Т-лимфоциты, сенсибилизированные к антигенам D. folliculorum), нейропептидами при стрессе (нейроиммунными механизмами) или формировании висцеро-кутанных рефлексов[8,13].

Дальнейшее развитие воспаления обусловлено секрецией кератиноцитами воспалительных протеаз (матричные металлопротеиназы, калликреинкиназы) и антимикробных пептидов (альфа-, бета-дефензины и кателицидин LL-37). В настоящее время именно кателицидину LL-37 отводится значимая роль в развитии розацеа.

Этот антимикробный полипептид, состоящий из 37 аминокислот, относится к семейству калликреин-кинина. Его уровень в пораженной коже значительно повышен при всех субтипах розацеа. Продукция LL-37 усиливается под влиянием УФО (за счет синтеза витамина D), высоких и низких температур, инфекционных агентов.

Внутрикожные инъекции LL-37 вызывают у экспериментальных животных развитие дерматита, клинически схожего с розацеа [14].

Несмотря на экзогенные или эндогенные причины возникновения за-

болевания, существенную роль в патогенезе розацеа большинство исследователей отводят сосудистым нарушениям.

Одной из причин нарушения регионарного кровообращения и микроциркуляции является эндотелиальная дисфункция, которая может приводить к спазму сосудов, усиленному тромбообразованию и адгезии лейкоцитов к эндотелию [4,5,12].

До конца не изучено участие системы гемостаза в патогенезе розацеа, взаимосвязь иммунных механизмов с клиническими проявлениями заболевания. Выяснение этих вопросов важно не только для раскрытия патогенеза, но и для разработки методов терапии и профилактики заболевания.

Взаимодействие механизмов врожденного иммунного ответа осуществляется на фоне повышенного количества в коже больных розацеа антимикробного пептида кателицидина, его активатора калликреина-5 (трипсинового фермента рогового слоя) и калликреина-7 (хемотрипсинового фермента рогового слоя) [6,9].

Кателлицидины-усилители низкомолекулярных белков, которые являются частью врожденного иммунного ответа, вовлечены в патогенез многих воспалительных заболеваний кожи. Это семейство антимикробных белков, которые, главным образом, обнаружены в пероксидазаотрицательных гранулах нейтрофилов [6,9].

Поскольку кателицидин LL-37 также способствует развитию и росту числа сосудов, при постоянном подавлении его экспрессии со временем можно добиться сокращения числа поверхностных сосудов на лице. Тем не менее, на сегодняшний день для подтверждения эффективности лечения, направленного на сокращение активности сериновых протеаз, требуется проведение дополнительных исследований.

Несмотря на наличие доказательной базы, говорящей в пользу гипотезы о том, что экспрессия калликреина-5 ведет к выработке кателицидина и возникновению воспаления, присущего розацеа, тот факт, что ни один из доступных сегодня методов лечения не избавляет полностью от всех видимых признаков болезни, заставляет предположить, что изучены еще не все механизмы розацеа. Считается, что нарушения деятельности нейро-васкулярной и нейро-иммунной систем также являются частью патофизиологии розацеа.

Понимание патогенетических механизмов заболевания, клиническая форма  (подтип) розацеа определяют выбор тактика общей и наружной терапии.

Под наблюдением находилось 19 пациентов в возрасте от 31до 48 лет (14 женщин и 5 мужчин), имеющих папуло —  пустулёзный подтип розацеа, осложнённый D. Folliculorum (подтверждённый лабораторно). Длительность заболевания у всех больных в среднем составляла от 1,5 до 8 лет.

Общая терапия включала в себя антибактериальные средства  (антибиотики, метронидазол), препараты ангиопротекторного действия, себорегулирующего действия – ретинола пальмитат, который  применяли в дозе 200 — 300 тыс.

МЕ в зависимости от веса больных,  1 раз в сутки на ночь. Лечения начинали с максимальной дозы, которую больные получали в течение 4 – 8 нед., затем в зависимости от динамики дозу препарата снижали и терапия продолжалась до 3, 5 мес.

В литературе имеются доказательства, что витамин А обладает тропизмом к малодифференцированным базальным себоцитам.

Под действием ретинола происходит усиление их пролиферации и ингибирование терминальной дифференцировки, что на органном уровне выражается в уменьшении размеров сальных желёз и снижении их активности в качестве продуцентов кожного сала [1].

Криообработка воспалительных инфильтратов с целью более быстрого их разрешения, а так же минимизации процессов рубцевания с экспозицией 5 – 10с на элемент проводилась ситуационно.

Проводили контроль биохимического анализа крови 1 раз в месяц. При анализе лабораторных данных не были зарегистрированы клинически значимые отклонения исследуемых показателей от допустимых значений.

У всех пациентов отмечалась сухость губ и кожи лица, которая устранялась применением наружных увлажняющих средств.

Оценка комплексной терапии розацеа, включающей применение ретинола пальмитата, показала положительную динамику клинических симптомов заболевания у 16 пациентов (80%) через 3 месяца от начала лечения.

В результате криообработки  воспалительных элементов наблюдался регресс воспалительных явлений и разрешение инфильтратов у 70% пациентов.

Патофизиологические механизмы возникновения и развития розацеа до сих пор являются предметом научных дискуссий. Отечественные и зарубежные исследования показывают участие большого количества иммунных клеток, антигена D.

Folliculorum, антимикробных пептидов, вазоактивных пептидов, клеток крови, медиаторов воспаления, приводящих последовательно к росту числа сосудов, воспалению и гиперплазии соединительной ткани.

Изучение и анализ взаимодействия факторов, участвующих в патогенезе розацеа, позволит усовершенствовать методы лечения и прогнозирование течения заболевания.

Литература:

1.Афанасьев Ю.И., Ноздрин В.И., Волков Ю.Т., Никифоров С.А. Витамин А – регулирующий фактор процессов гистогенеза. Успехи соврем биол 1990; 110: 410–418.

2.Ахтямов С.Н., Бутов Ю.С.// Практическая дерматокосметология// учебное пособие. – М.: Медицина, 2003  С. 277

3.Избранные лекции по дерматовенерологии под редакцией Баткаева Э.А.,М.,2010

4.Сницаренко О. В. Вазоактивные полипептиды при розацеа // Вестн. дерматол. и венерол. 1995. № 9. С. 42–44.

5.Самцов A. B. Учебно-исследовательская лаборатория клинической дерматогистопатологии на основе систем искусственного интеллекта // Вестн. Рос. воен.‑мед. акад. 2000. № 1.С 94–97.

  1. Angiogenesis in cutaneous disease: part II / V. Laquer, V. Hoang, A. Nguyen, K. M. Kelly // J. Am. Acad. Dermatol. 2009.Vol. 61, № 6. Р. 945–960.
  2. Increased serine protease activity and cathelicidin promotes skin inflammation in rosacea / К. Yamasaki, D. А. Nardo, А. Bardan [et al.] // Nat. Med. 2007. № 13. Р. 975–980.
  3. IL-17A enhances vitamin D3‑induced expression of cathelicidin antimicrobial peptide in human keratinocytes /М. Peric, S. Koglin, S. M. Kim [et al.] // J. Immunol. 2008. № 181. Р. 8504–8512.
  4. Injury enhances TLR2 function and antimicrobial peptide expression through a vitamin D-dependent mechanism /J. Schauber, R. A. Dorschner, A. B. Coda [et al.] // J. Clin. Invest.2007. № 117. Р. 803–811.
  5. Keratinocyte production of cathelicidin provides direct activity against bacterial skin pathogens / М. Н. Braff, М. Zaiou, J. Fierer [et al.] // Infect. Immun. 2005. № 73. Р. 6771–6781.
  6. Laser and light therapies for acne rosacea / K. L. Butterwick [et al.] // J. Drugs Dermatol. 2006. Vol. 5, № 3. pt. 35. P. 9.

12.Objective and Quantitative Improvement of Rosacea-Associated Erythema after IPL Treatment / K. A. Mark, R. M. Sparacio, A. Voigt [et al.] // Dermatol. Surg. 2003. Vol. 29. P. 600–604.

13.Steinhoff M., Schauber J., Leyden J.J. New insights into rosacea pathophysiology: a review of recent findings // J. Am. Acad. Dermatol. 2013. Vol. 69. № 6. Suppl. 1. P. S15–26.

14.Yamasaki K., Gallo R.L. Rosacea as a disease of cathelicidins and skin innate immunity // J. Investig. Dermatol. Symp. Proc. 2011. Vol. 15. № 1. P. 12–15.

Источник: http://cryokosmet.ru/rozatsea-kompleksnaya-terapiya/

Medic-studio
Добавить комментарий